Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA5-FRT/TO-mNeonGreen-BRD4-p300(H*IT)
(Plasmid #204698)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204698 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA5
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5160
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BRD4-p300(H*IT)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    10158
  • Mutation
    D1399Y substitution in p300
  • Entrez Gene
    BRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
  • Entrez Gene
    EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeonGreen (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCATAGAAGACACCGGGACCGATCC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

NLS, mNeonGreen, other inserts are a fusion of two genes / All our plasmids are pcDNA5-FRT/TO and are used in a co-transfection with Flp recombinase expression vector, pOG44.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5-FRT/TO-mNeonGreen-BRD4-p300(H*IT) was a gift from Michael Rosen (Addgene plasmid # 204698 ; http://n2t.net/addgene:204698 ; RRID:Addgene_204698)
  • For your References section:

    Molecular features driving condensate formation and gene expression by the BRD4-NUT fusion oncoprotein are overlapping but distinct. Kosno M, Currie SL, Kumar A, Xing C, Rosen MK. Sci Rep. 2023 Jul 24;13(1):11907. doi: 10.1038/s41598-023-39102-9. 10.1038/s41598-023-39102-9 PubMed 37488172