pcDNA5-FRT/TO-mNeonGreen-BRD4-NUT(MIN)
(Plasmid #204695)

• Purpose: This plasmid allows for inducible expression of BRD4-NUT(MIN) mutant fusion tagged with mNeonGreen, in mammalian cells.
• Depositing Lab: Michael Rosen
• Publication: Kosno et al Sci Rep. 2023 Jul 24;13(1):11907. doi: 10.1038/s41598-023-39102-9.

Backbone

• Vector backbone: pcDNA5
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 5160
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BRD4-NUT(MIN)
• Species: H. sapiens (human)
• Insert Size (bp): 3381
• Mutation: deletion of majority of NUT, retaining only amino acids 355-505
• Entrez Gene: BRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
• Entrez Gene: NUTM1 (a.k.a. C15orf55, FAM22H, NUT)
• Promoter: CMV
• Tag / Fusion Protein:
  • mNeonGreen (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CCATAGAAGACACCGGGACCGATCC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

NLS, mNeonGreen other inserts are a fusion of two genes / All our plasmids are pcDNA5-FRT/TO and are used in a co-transfection with Flp recombinase expression vector, pOG44.