Skip to main content
Addgene

pcDNA5-FRT/TO-mNeonGreen-BRD4
(Plasmid #204692)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204692 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA5
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5160
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BRD4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2916
  • Mutation
    n/a
  • Entrez Gene
    BRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeonGreen (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCATAGAAGACACCGGGACCGATCC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    purchaced from McDermot Center for Human Growth and Development @ UTSW

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

NLS, mNeonGreen / All our plasmids are pcDNA5-FRT/TO and are used in a co-transfection with Flp recombinase expression vector, pOG44.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5-FRT/TO-mNeonGreen-BRD4 was a gift from Michael Rosen (Addgene plasmid # 204692 ; http://n2t.net/addgene:204692 ; RRID:Addgene_204692)

  • For your References section:

    Molecular features driving condensate formation and gene expression by the BRD4-NUT fusion oncoprotein are overlapping but distinct. Kosno M, Currie SL, Kumar A, Xing C, Rosen MK. Sci Rep. 2023 Jul 24;13(1):11907. doi: 10.1038/s41598-023-39102-9. 10.1038/s41598-023-39102-9 PubMed 37488172
Related items:
Commonly requested with: