Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pH2rU3_ForInd_mCherry_CMV_ZsGT2APurR
(Plasmid #204579)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204579 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pH2rU3
  • Total vector size (bp) 9340
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    711
  • Promoter TRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer cagccgagccacatcgc
  • 3′ sequencing primer gttatgtaacgcggaactccactagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For cloning lentiviral entry proteins into this plasmid digest it with MluI and AscI enzymes and use HiFi reaction to clone in the viral protein.

For making non-neutralizible standard you need to first barcode mCherry gene. To do so amplify mChery from the backbone using forward (CAGCCGAGCCACATCGCTC)
and reverse (CGGAAGAGCGTCGTGTAGGGAAAG) primers and gel purify the product. Use the product to barcode the mCherry gene using forward primer (gcacgcgCAGCCGAGCCACATCGCTCA) and one if reverse the primers containing unique barcodes. (gcggaactccactaggaacatttctctctcgaaTCTAGAtactttactactgcacAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAggaccattgcgacgtaAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAcctagccactagatggAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAatggagggagtctactAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAtagtgtaaacgccacgAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAccaacgcgtgaatcgcAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAatcgtatccatgggtaAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAggtcacgtgtctatatAGATCGGAAGAGCGTCGTGTAGGGAAAGAG). Gel and bead purify the products and perform HiFi reaction to insert the barcoded gene into pH2rU3_ForInd_mCherry_CMV_ZsGT2APurR vector that has been digested with MluI and XbaI enzymes. Transform the HiFi reaction into stable cells (e.g. NEB 10b cells). Screen colonies for correct barcodes and pool all 8 barcoded plasmids together before performing lentivirus rescues.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pH2rU3_ForInd_mCherry_CMV_ZsGT2APurR was a gift from Jesse Bloom (Addgene plasmid # 204579 ; http://n2t.net/addgene:204579 ; RRID:Addgene_204579)
  • For your References section:

    A pseudovirus system enables deep mutational scanning of the full SARS-CoV-2 spike. Dadonaite B, Crawford KHD, Radford CE, Farrell AG, Yu TC, Hannon WW, Zhou P, Andrabi R, Burton DR, Liu L, Ho DD, Chu HY, Neher RA, Bloom JD. Cell. 2023 Mar 16;186(6):1263-1278.e20. doi: 10.1016/j.cell.2023.02.001. Epub 2023 Feb 13. 10.1016/j.cell.2023.02.001 PubMed 36868218