Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pH2rU3_ForInd_sinobiological_617.2_Spiked21_CMV_ZsGT2APurR
(Plasmid #204151)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 204151 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pH2rU3
  • Total vector size (bp) 12386
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Delta variant spike
  • Species
    SARS-CoV-2
  • Mutation
    21 amino acid cytoplasmic tail deletion
  • Promoter TRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer cagccgagccacatcgc
  • 3′ sequencing primer gttatgtaacgcggaactccactagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pH2rU3_ForInd_sinobiological_617.2_Spiked21_CMV_ZsGT2APurR was a gift from Jesse Bloom (Addgene plasmid # 204151 ; http://n2t.net/addgene:204151 ; RRID:Addgene_204151)
  • For your References section:

    A pseudovirus system enables deep mutational scanning of the full SARS-CoV-2 spike. Dadonaite B, Crawford KHD, Radford CE, Farrell AG, Yu TC, Hannon WW, Zhou P, Andrabi R, Burton DR, Liu L, Ho DD, Chu HY, Neher RA, Bloom JD. Cell. 2023 Mar 16;186(6):1263-1278.e20. doi: 10.1016/j.cell.2023.02.001. Epub 2023 Feb 13. 10.1016/j.cell.2023.02.001 PubMed 36868218