Skip to main content
Addgene

HDM_Spikedelta21_sinobiological_B.1.617.2
(Plasmid #204149)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204149 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    HDM
  • Total vector size (bp) 8305
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Delta variant spike
  • Species
    SARS-CoV-2
  • Insert Size (bp)
    3753
  • Mutation
    21 amino acid cytoplasmic tail deletion
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggcccttttgctaatcatgttcatacctcttatct
  • 3′ sequencing primer gccagggcattagccacacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HDM_Spikedelta21_sinobiological_B.1.617.2 was a gift from Jesse Bloom (Addgene plasmid # 204149 ; http://n2t.net/addgene:204149 ; RRID:Addgene_204149)
  • For your References section:

    A pseudovirus system enables deep mutational scanning of the full SARS-CoV-2 spike. Dadonaite B, Crawford KHD, Radford CE, Farrell AG, Yu TC, Hannon WW, Zhou P, Andrabi R, Burton DR, Liu L, Ho DD, Chu HY, Neher RA, Bloom JD. Cell. 2023 Mar 16;186(6):1263-1278.e20. doi: 10.1016/j.cell.2023.02.001. Epub 2023 Feb 13. 10.1016/j.cell.2023.02.001 PubMed 36868218