Skip to main content
Addgene

pH2rU3_ForInd_Omicron_sinobiological_Spiked21_T7_CMV_ZsGT2APurR
(Plasmid #204146)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204146 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pH2rU3
  • Total vector size (bp) 12403
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SARS-CoV-2 BA.1 variant spike
  • Species
    SARS-CoV-2
  • Insert Size (bp)
    3757
  • Mutation
    21 amino acid cytoplasmic tail deletion
  • Promoter TRE3G

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer cagccgagccacatcgc
  • 3′ sequencing primer gttatgtaacgcggaactccactagg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    zsGreen-T2A-PuR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1365
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer ccgtcagatcgcctggagac
  • 3′ sequencing primer ccacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pH2rU3_ForInd_Omicron_sinobiological_Spiked21_T7_CMV_ZsGT2APurR was a gift from Jesse Bloom (Addgene plasmid # 204146 ; http://n2t.net/addgene:204146 ; RRID:Addgene_204146)
  • For your References section:

    A pseudovirus system enables deep mutational scanning of the full SARS-CoV-2 spike. Dadonaite B, Crawford KHD, Radford CE, Farrell AG, Yu TC, Hannon WW, Zhou P, Andrabi R, Burton DR, Liu L, Ho DD, Chu HY, Neher RA, Bloom JD. Cell. 2023 Mar 16;186(6):1263-1278.e20. doi: 10.1016/j.cell.2023.02.001. Epub 2023 Feb 13. 10.1016/j.cell.2023.02.001 PubMed 36868218