opto-E-cad GFP
(Plasmid
#203327)
-
PurposeExpresses E-cadherin with a LOV2 insert after T133 for blue light inhibition in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203327 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePhotoswitchable - E-cadherin with GFP tag
-
Alt nameopto-E-cad
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3783
-
MutationAddition of Aslov2 domain at T133 of human E-cadherin
-
GenBank ID
-
Entrez GeneCDH1 (a.k.a. Arc-1, BCDS1, CD324, CDHE, ECAD, LCAM, UVO)
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGATGGAGGTCACAGCCACACTGGCGACCACCCTGGAACG
- 3′ sequencing primer GTTCACATCATCGTCCGCGTCCGCTTCATCAATGTTTTCCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe E-cadherin GFP plasmid was a gift from Jennifer Stow, Addgene plasmid #28009 The AsLOV2 domain was a gift from Brian Kuhlman and amplified from Addgene plasmid #40236
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
opto-E-cad GFP was a gift from Seraphine Wegner (Addgene plasmid # 203327 ; http://n2t.net/addgene:203327 ; RRID:Addgene_203327) -
For your References section:
Reversible photoregulation of cell-cell adhesions with opto-E-cadherin. Nzigou Mombo B, Bijonowski BM, Raab CA, Niland S, Brockhaus K, Muller M, Eble JA, Wegner SV. Nat Commun. 2023 Oct 9;14(1):6292. doi: 10.1038/s41467-023-41932-0. 10.1038/s41467-023-41932-0 PubMed 37813868