pCROPseq-VEX-optimized-scaffold
(Plasmid
#203321)
-
PurposeModified CROPseq vector for efficient CRISPR screens in hematopoiesis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203321 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiGuide-puro
-
Backbone manufacturerFeng Zhang Lab
- Total vector size (bp) 10344
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersVEX-GFP (excitation with violet laser and readout in the GFP channel)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequenceFiller needs to be replaced by individual sgRNA or pooled library
-
SpeciesSynthetic
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gagggcctatttcccatgatt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCROPseq-VEX-optimized-scaffold was a gift from Vijay Sankaran (Addgene plasmid # 203321 ; http://n2t.net/addgene:203321 ; RRID:Addgene_203321) -
For your References section:
Massively parallel base editing to map variant effects in human hematopoiesis. Martin-Rufino JD, Castano N, Pang M, Grody EI, Joubran S, Caulier A, Wahlster L, Li T, Qiu X, Riera-Escandell AM, Newby GA, Al'Khafaji A, Chaudhary S, Black S, Weng C, Munson G, Liu DR, Wlodarski MW, Sims K, Oakley JH, Fasano RM, Xavier RJ, Lander ES, Klein DE, Sankaran VG. Cell. 2023 Apr 27:S0092-8674(23)00332-X. doi: 10.1016/j.cell.2023.03.035. 10.1016/j.cell.2023.03.035 PubMed 37137305