His-DNPH1
(Plasmid #203224)

• Purpose: For protein expression. Human DNPH1 is an N-glycosidase with specificity toward 5-hydroxymethyl uridine monophosphate. Pet28a plasmid, KAN resistant, N-terminal TEV-cleavable 6xHis tag.
• Depositing Lab: Vern Schramm
• Publication: Wagner et al Anal Biochem. 2023 Jul 1;672:115171. doi: 10.1016/j.ab.2023.115171. Epub 2023 May 3.

Backbone

• Vector backbone: pet28a
• Backbone size w/o insert (bp): 5237
• Total vector size (bp): 5801
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: DNPH1
• Alt name: rcl
• Alt name: Uniprot: O43598
• Species: H. sapiens (human)
• Insert Size (bp): 564
• Entrez Gene: DNPH1 (a.k.a. C6orf108, RCL, dJ330M21.3)
• Promoter: T7
• Tag / Fusion Protein:
  • His tag (with TEV cleavage site) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Genscript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry