Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

His-AgdNK
(Plasmid #203226)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 203226 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pet28a
  • Backbone size w/o insert (bp) 5237
  • Total vector size (bp) 6017
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    deoxynucleoside kinase
  • Alt name
    dNK
  • Alt name
    AgdNK
  • Species
    Anopheles gambiae
  • Insert Size (bp)
    780
  • Entrez Gene
    AgaP_AGAP001585 (a.k.a. AgaP_AGAP001585, AgaP_ENSANGG00000014878, ENSANGG00000014878)
  • Tag / Fusion Protein
    • N-terminal TEV cleavable 6xHis tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Genscript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His-AgdNK was a gift from Vern Schramm (Addgene plasmid # 203226 ; http://n2t.net/addgene:203226 ; RRID:Addgene_203226)
  • For your References section:

    An enzyme-coupled microplate assay for activity and inhibition of hmdUMP hydrolysis by DNPH1. Wagner AG, Eskandari R, Schramm VL. Anal Biochem. 2023 Jul 1;672:115171. doi: 10.1016/j.ab.2023.115171. Epub 2023 May 3. 10.1016/j.ab.2023.115171 PubMed 37142196