Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGK-HELLO-T2A-Cre LV
(Plasmid #202003)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 202003 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Lenti backbone
  • Backbone size w/o insert (bp) 5818
  • Total vector size (bp) 8852
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HELLO-T2A-Cre
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2562
  • Promoter pGK
  • Tag / Fusion Protein
    • FLAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCCGGGTCGACTAGTGATCAGTG
  • 3′ sequencing primer GTTGATTATCGGGCGCGCCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGK-HELLO-T2A-Cre LV was a gift from Nikhil Joshi (Addgene plasmid # 202003 ; http://n2t.net/addgene:202003 ; RRID:Addgene_202003)
  • For your References section:

    Neoantigen-driven B cell and CD4 T follicular helper cell collaboration promotes anti-tumor CD8 T cell responses. Cui C, Wang J, Fagerberg E, Chen PM, Connolly KA, Damo M, Cheung JF, Mao T, Askari AS, Chen S, Fitzgerald B, Foster GG, Eisenbarth SC, Zhao H, Craft J, Joshi NS. Cell. 2021 Dec 9;184(25):6101-6118.e13. doi: 10.1016/j.cell.2021.11.007. Epub 2021 Nov 30. 10.1016/j.cell.2021.11.007 PubMed 34852236