Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

NINJA TC
(Plasmid #159274)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159274 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pZDonor
  • Backbone manufacturer
    Millipore Sigma
  • Backbone size w/o insert (bp) 6417
  • Total vector size (bp) 14921
  • Vector type
    Mammalian Expression, Mouse Targeting
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NINJA TC
  • Alt name
    NINJA Targeting Construct
  • Species
    H. sapiens (human), M. musculus (mouse), G. gallus (chicken), Synthetic; jellyfish, phage
  • Insert Size (bp)
    8504

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCTCTTCCCTCGTGATCTG
  • 3′ sequencing primer GTCGAGGTGCCCGAAGGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Puromycin resistance is deleted after Cre recombination.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NINJA TC was a gift from Nikhil Joshi (Addgene plasmid # 159274 ; http://n2t.net/addgene:159274 ; RRID:Addgene_159274)
  • For your References section:

    Inducible de novo expression of neoantigens in tumor cells and mice. Damo M, Fitzgerald B, Lu Y, Nader M, William I, Cheung JF, Connolly KA, Foster GG, Akama-Garren E, Lee DY, Chang GP, Gocheva V, Schmidt LM, Boileve A, Wilson JH, Cui C, Monroy I, Gokare P, Cabeceiras P, Jacks T, Joshi NS. Nat Biotechnol. 2020 Jul 27. pii: 10.1038/s41587-020-0613-1. doi: 10.1038/s41587-020-0613-1. 10.1038/s41587-020-0613-1 PubMed 32719479