Skip to main content
Addgene

pAAV-EF1_Cre
(Plasmid #201198)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201198 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV-TRE-flex-Clover
  • Backbone manufacturer
    addgene Plasmid #135177
  • Modifications to backbone
    Replacement of TRE-flex-clover insert with EF1alpha-cre (WPRE is retained)
  • Vector type
    Mammalian Expression, Bacterial Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    cre
  • Insert Size (bp)
    1053
  • Mutation
    nuclear targeting cre
  • GenBank ID
  • Promoter hEF1alpha promoter

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CTGAAGTTAGGCCAGCTTGG
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EF1alpha promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    376
  • Promoter N/A

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.12.26.474213 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1_Cre was a gift from Tetsuo Yamamori (Addgene plasmid # 201198 ; http://n2t.net/addgene:201198 ; RRID:Addgene_201198)

  • For your References section:

    Local and long-distance organization of prefrontal cortex circuits in the marmoset brain. Watakabe A, Skibbe H, Nakae K, Abe H, Ichinohe N, Rachmadi MF, Wang J, Takaji M, Mizukami H, Woodward A, Gong R, Hata J, Van Essen DC, Okano H, Ishii S, Yamamori T. Neuron. 2023 May 9:S0896-6273(23)00338-0. doi: 10.1016/j.neuron.2023.04.028. 10.1016/j.neuron.2023.04.028 PubMed 37196659
Related items:
Commonly requested with: