pSX2720
(Plasmid
#200764)
-
PurposeExpresses Superfolder GFP-tag fused single change variable fragment antibody of GCN4 (Suntag) with the tissue-specific promoter col-19 in C. elegans.
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCR8
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namescFv-sfGFP
-
Alt namescFv-sfGFP
-
SpeciesC. elegans (nematode)
- Promoter col-19
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtacaggtagagctcaccggtgcaaccatgggccccgac
- 3′ sequencing primer gctgggtcgaattcgcccttttactctagactcgagcggc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSX2720 was a gift from Suhong Xu (Addgene plasmid # 200764 ; http://n2t.net/addgene:200764 ; RRID:Addgene_200764) -
For your References section:
Enhanced single RNA imaging reveals dynamic gene expression in live animals. Hu Y, Xu J, Gao E, Fan X, Wei J, Ye B, Xu S, Ma W. Elife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. 10.7554/eLife.82178 PubMed 36867026