pSX2719
(Plasmid
#200763)
-
PurposeExpresses mCherry fused MS2 coat protein and 24xGCN4 (Suntag) with the tissue-specific promoter semo-1 in C. elegans.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePsemo-1
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMCP-24xGCN4
-
SpeciesC. elegans (nematode)
- Promoter semo-1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcacaagtttgtacaaaaaagcaggctatggcttctaactttactcagttcg
- 3′ sequencing primer gtgccgccaagaaaaaagtctcattaacccgagccagaaccc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSX2719 was a gift from Suhong Xu (Addgene plasmid # 200763 ; http://n2t.net/addgene:200763 ; RRID:Addgene_200763) -
For your References section:
Enhanced single RNA imaging reveals dynamic gene expression in live animals. Hu Y, Xu J, Gao E, Fan X, Wei J, Ye B, Xu S, Ma W. Elife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. 10.7554/eLife.82178 PubMed 36867026