pcDNA3.1_27F3_hFc
(Plasmid
#199619)
-
PurposeEncodes DARPin-hFc 27F3 for mammalian expression and column purification
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6800
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDARPin-hFc 27F3
-
SpeciesSynthetic
- Promoter CMV
-
Tag
/ Fusion Protein
- hFc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HTC DARPin name 008-855-2309-D7
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_27F3_hFc was a gift from Shiva Tyagarajan (Addgene plasmid # 199619 ; http://n2t.net/addgene:199619 ; RRID:Addgene_199619) -
For your References section:
A DARPin-based molecular toolset to probe gephyrin and inhibitory synapse biology. Campbell BFN, Dittmann A, Dreier B, Pluckthun A, Tyagarajan SK. Elife. 2022 Oct 31;11:e80895. doi: 10.7554/eLife.80895. 10.7554/eLife.80895 PubMed 36314779