pEGFPC2-gephyrin C4a
(Plasmid #199611)

• Purpose: Encodes N-terminal eGFP-tagged gephyrin including the C4a splice cassette for expression in mammalian cells.
• Depositing Lab: Shiva Tyagarajan
• Publication: Campbell et al Elife. 2022 Oct 31;11:e80895. doi: 10.7554/eLife.80895.

Backbone

• Vector backbone: pEGFPC2
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Gephyrin
• Species: R. norvegicus (rat)
• Mutation: C4a casette insertion
• Entrez Gene: Gphn (a.k.a. Geph)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Gephyrin C4a cassette encodes ARLPSCSSTYSVSE after K288 (expressed in neurons and promotes oligomerization of gephyrin molecules for synapse scaffolding. Inhibitory synapse distribution for C4a and P1 variant of gephyrin currently unknown)