pEGFPC2-gephyrin C4a
(Plasmid
#199611)
-
PurposeEncodes N-terminal eGFP-tagged gephyrin including the C4a splice cassette for expression in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFPC2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGephyrin
-
SpeciesR. norvegicus (rat)
-
MutationC4a casette insertion
-
Entrez GeneGphn (a.k.a. Geph)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Gephyrin C4a cassette encodes ARLPSCSSTYSVSE after K288 (expressed in neurons and promotes oligomerization of gephyrin molecules for synapse scaffolding. Inhibitory synapse distribution for C4a and P1 variant of gephyrin currently unknown)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFPC2-gephyrin C4a was a gift from Shiva Tyagarajan (Addgene plasmid # 199611 ; http://n2t.net/addgene:199611 ; RRID:Addgene_199611) -
For your References section:
A DARPin-based molecular toolset to probe gephyrin and inhibitory synapse biology. Campbell BFN, Dittmann A, Dreier B, Pluckthun A, Tyagarajan SK. Elife. 2022 Oct 31;11:e80895. doi: 10.7554/eLife.80895. 10.7554/eLife.80895 PubMed 36314779