Skip to main content
Addgene

pEGFPC2-gephyrin C4a
(Plasmid #199611)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199611 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFPC2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gephyrin
  • Species
    R. norvegicus (rat)
  • Mutation
    C4a casette insertion
  • Entrez Gene
    Gphn (a.k.a. Geph)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gephyrin C4a cassette encodes ARLPSCSSTYSVSE after K288 (expressed in neurons and promotes oligomerization of gephyrin molecules for synapse scaffolding. Inhibitory synapse distribution for C4a and P1 variant of gephyrin currently unknown)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFPC2-gephyrin C4a was a gift from Shiva Tyagarajan (Addgene plasmid # 199611 ; http://n2t.net/addgene:199611 ; RRID:Addgene_199611)

  • For your References section:

    A DARPin-based molecular toolset to probe gephyrin and inhibitory synapse biology. Campbell BFN, Dittmann A, Dreier B, Pluckthun A, Tyagarajan SK. Elife. 2022 Oct 31;11:e80895. doi: 10.7554/eLife.80895. 10.7554/eLife.80895 PubMed 36314779
Related items: