pMDC32B-BS-AtMIR390a-B/c
(Plasmid #199560)

• Purpose: Plant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stem
• Depositing Lab: Alberto Carbonell
• Publication: Cisneros et al Nucleic Acids Res. 2023 Oct 27;51(19):10719-10736. doi: 10.1093/nar/gkad747.

Backbone

• Vector backbone: pMDC32
• Backbone size w/o insert (bp): 10133
• Total vector size (bp): 11629
• Vector type: RNAi
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Basal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites
• Alt name: BS-AtMIR390a-B/c
• Alt name: MIR390a
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1496
• GenBank ID: AT2G38325
• Entrez Gene: MIR390a (a.k.a. AT2G38325, MICRORNA 390, MIR390, MIR390A, microRNA390A, p_MI0001000)
• Promoter: 2x35S

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: attB1 (ACAAGTTTGTACAAAAAAGCAGGCT)
• 3′ sequencing primer: attB2 (ACCACTTTGTACAAGAAAGCTGGGT)

Resource Information

• Supplemental Documents:
  • pMDC32B-BS-AtMIR390a-BC.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry