Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-C3-Rabaptin-5
(Plasmid #199173)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199173 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C3
  • Backbone size w/o insert (bp) 4727
  • Total vector size (bp) 7452
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rabaptin-5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2726
  • Mutation
    Contains Tyr 149 Ser substitution; insert starts at codon 6 (encodes human Rabaptin-5 (6-862))
  • Entrez Gene
    RABEP1 (a.k.a. RAB5EP, RABPT5)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer pEGFP-C forward: 5’ CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer pEGFP-C reverse: 5’ GCTTTATTTGTGAAATTTGTGATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ApaI/NotI Rabaptin-5 insert was polished with T7 DNA polymerase and subcloned into SmaI site of pEGFP-C3 vector. Insert contains ~140 bp of 3' UTR after stop codon.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C3-Rabaptin-5 was a gift from Juan Bonifacino (Addgene plasmid # 199173 ; http://n2t.net/addgene:199173 ; RRID:Addgene_199173)
  • For your References section:

    Divalent interaction of the GGAs with the Rabaptin-5-Rabex-5 complex. Mattera R, Arighi CN, Lodge R, Zerial M, Bonifacino JS. EMBO J. 2003 Jan 2;22(1):78-88. doi: 10.1093/emboj/cdg015. 10.1093/emboj/cdg015 PubMed 12505986