Skip to main content
Addgene

pAAV_CaMKIIa(0.4)-PdCO-EGFP-WPRE
(Plasmid #198514)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198514 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3785
  • Total vector size (bp) 5702
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PdCO
  • Alt name
    Platynereis dumerilii Ciliary Opsin, optimized for mammalian neuron expression and enhanced axonal membrane trafficking
  • Species
    Synthetic; Platynereis dumerilii
  • Insert Size (bp)
    1917
  • GenBank ID
    AY692353.1
  • Promoter CaMKIIα minimal promotor (0.4kb)
  • Tags / Fusion Proteins
    • EGFP (C terminal on insert)
    • Rho1D4 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CaMKIIa_F (gtttcggaggtggttgccatg)
  • 3′ sequencing primer WPRE_R (ACCACGGAATTATCAGTGCCCA)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_CaMKIIa(0.4)-PdCO-EGFP-WPRE was a gift from Ofer Yizhar (Addgene plasmid # 198514 ; http://n2t.net/addgene:198514 ; RRID:Addgene_198514)

  • For your References section:

    A bistable inhibitory optoGPCR for multiplexed optogenetic control of neural circuits. Wietek J, Nozownik A, Pulin M, Saraf-Sinik I, Matosevich N, Gowrishankar R, Gat A, Malan D, Brown BJ, Dine J, Imambocus BN, Levy R, Sauter K, Litvin A, Regev N, Subramaniam S, Abrera K, Summarli D, Goren EM, Mizrachi G, Bitton E, Benjamin A, Copits BA, Sasse P, Rost BR, Schmitz D, Bruchas MR, Soba P, Oren-Suissa M, Nir Y, Wiegert JS, Yizhar O. Nat Methods. 2024 May 29. doi: 10.1038/s41592-024-02285-8. 10.1038/s41592-024-02285-8 PubMed 38811857
Related items:
Commonly requested with: