pCAG-EGFP/RFP-int
(Plasmid #19818)

• Purpose: (Empty Backbone)
• Depositing Lab: Zuoshang Xu
• Publication: Qiu et al BMC Biotechnol. 2008 . 8():77.

Backbone

• Vector backbone: pZ/AP
• Backbone size (bp): 8200
• Vector type: Mammalian Expression, RNAi, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: empty vector

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AsiSI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: GCTGGACATCACCTCCCACAACG
• 3′ sequencing primer: ACAGGAGGTGGGGAGCAGGAGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The lacZ and the human placental alkaline phosphatase (AP) genes in the pZ/AP vector were replaced with EGFP, synthesized by PCR from pEGFP-N1 (Clontech), and RFP, synthesized by PCR from pDsRed2-C1 (Clontech), respectively. One cryptic start codon at the 5'UTR of the original AP gene that was not in frame was eliminated. These modifications produced a conditional vector for miRNA expression, pCAG-EGFP/RFP. A synthetic artificial intron was designed to contain typical intron splicing regulatory elements. This intron was placed 10 nt-downstream of the stop codon of the RFP gene to avoid NMD.