pL1P3 ZmUbiP:GRF-GIF:NosT
(Plasmid #198047)

• Purpose: MoClo Golden Gate Level 1 Position 3. Overexpression cassette of Growth-Regulating Factor 4 (GRF4) plus GRF-Interacting Factor 1 (GRF4-GIF1). Improves in vitro wheat regeneration and transformation.
• Depositing Labs: John Innes Centre - Crop Transformation and Genome Editing Group, Cristobal Uauy
• Publication: Golden Gate Level 1 plasmids containing the wheat GRF4-GIF1 gene fusion (unpublished)

Backbone

• Vector backbone: pICH47751 AddGene #48002
• Backbone manufacturer: Sylvestre Marillonnet
• Backbone size w/o insert (bp): 4348
• Total vector size (bp): 8543
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZmUbiP::TaGRF4-GIF1::NosT
• Alt name: Overexpression Growth-Regulating Factor 4 and cofactor GRF-Interacting Factor 1
• Species: Synthetic
• Insert Size (bp): 4195
• Promoter: Zea mays (maize) ubiquitin promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Eco31I (BsaI) (destroyed during cloning)
• 3′ cloning site: Eco31I (BsaI) (destroyed during cloning)
• 5′ sequencing primer: GAACCCTGTGGTTGGCATGCACATAC
• 3′ sequencing primer: CTGGTGGCAGGATATATTGTGGTG

Resource Information

• Supplemental Documents:
  • pl1p3-zmubipgrf-gifnost.gb
• A portion of this plasmid was derived from a plasmid made by: Debernardi JM, Tricoli DM, Ercoli MF, Hayta S, Ronald P, Palatnik JF, Dubcovsky J. Nat Biotechnol 38, 1274–1279 (2020). We acknowledge the researchers at UC Davis and HHMI for the development of GRF4-GIF1 fusion reported in PMID: 33046875.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry