Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-GfaABC1D-iCreV-4x6T
(Plasmid #196412)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196412 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 3406
  • Total vector size (bp) 6855
  • Modifications to backbone
    The GfaABC1D promoter and the 4x6T miRNA targeting cassette were added to confer astrocyte specificity.
  • Vector type
    Mammalian Expression, AAV ; Astrocyte-selective

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    iCreV
  • Alt name
    Light-inducible Cre recombinase
  • Species
    Synthetic
  • Insert Size (bp)
    2040
  • Promoter GfaABC1D

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tagcccactccttcataaag
  • 3′ sequencing primer ttattaggacaaggctggtg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    AAV-GfaABC1D-iCreV-4x6T was created using AAV pmSyn1-EBFP-Cre (Addgene 51507) provided by Hongkui Zeng and iCreV (Addgene 140135) provided by Hongkui Zeng.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-GfaABC1D-iCreV-4x6T was a gift from Stanley Thomas Carmichael (Addgene plasmid # 196412 ; http://n2t.net/addgene:196412 ; RRID:Addgene_196412)
  • For your References section:

    A toolbox of astrocyte-specific, serotype-independent adeno-associated viral vectors using microRNA targeting sequences. Gleichman AJ, Kawaguchi R, Sofroniew MV, Carmichael ST. Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w. 10.1038/s41467-023-42746-w PubMed 37973910