AAV-CAG-dDIO-MCS--4x6T
(Plasmid
#196422)
-
Purpose(Empty Backbone) Empty vector for astrocyte-selective Dre-dependent AAV expression; astrocyte selectivity generated with 4x6T miRNA targeting cassette
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneAAV-FLEX (Addgene 28304)
-
Backbone manufacturerScott Sternson
- Backbone size (bp) 4699
-
Modifications to backboneReplaced loxP/lox2272 sites with roxP/rox2 sites; added multiple cloning sites and 4x6T miR targeting cassette for astrocyte selectivity
-
Vector typeMammalian Expression, AAV ; Dre/Rox; astrocyte-selective
- Promoter CAG
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer ttaaagcagcgtatccacat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAAV-CAG-dDIO-MCS--4x6T was created using pAAV-FLEX-GFP (Addgene 28304) provided by Ed Boyden and dDIO sites (Addgene 55640) provided by Karl Deisseroth.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.21.529451v2 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CAG-dDIO-MCS--4x6T was a gift from Stanley Thomas Carmichael (Addgene plasmid # 196422 ; http://n2t.net/addgene:196422 ; RRID:Addgene_196422) -
For your References section:
A toolbox of astrocyte-specific, serotype-independent adeno-associated viral vectors using microRNA targeting sequences. Gleichman AJ, Kawaguchi R, Sofroniew MV, Carmichael ST. Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w. 10.1038/s41467-023-42746-w PubMed 37973910
Map uploaded by the depositor.
