Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMG071 MBP-GSK3β_S9A-HA-His, GST_λPPase
(Plasmid #196185)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196185 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMBP-MG
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6716
  • Total vector size (bp) 9466
  • Modifications to backbone
    Modified to include an N-terminal TEV-cleavable MBP tag and a C-terminal His6 tag
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    GSK3B
  • Alt name
    Glycogen Synthase Kinase 3β
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1305
  • Mutation
    changed Serine 9 to Alanine
  • GenBank ID
    2932 BC000251
  • Entrez Gene
    GSK3B
  • Promoter Tac
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • His6 (C terminal on backbone)
    • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer MalE Forward GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer GST_N Reverse GAGTGGGTTGCACAAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    λPPase
  • Alt name
    Lambda Phosphatase
  • Alt name
    serine/threonine protein phosphatase [Escherichia phage Lambda]
  • Species
    Bacteriophage lambda
  • Insert Size (bp)
    666
  • GenBank ID
    NC_001416.1
  • Promoter Tac
  • Tag / Fusion Protein
    • GST (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer M13F Reverse TGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #14753

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMG071 MBP-GSK3β_S9A-HA-His, GST_λPPase was a gift from Jesse Zalatan (Addgene plasmid # 196185 ; http://n2t.net/addgene:196185 ; RRID:Addgene_196185)
  • For your References section:

    The Axin scaffold protects the kinase GSK3beta from cross-pathway inhibition. Gavagan M, Jameson N, Zalatan JG. Elife. 2023 Aug 7;12:e85444. doi: 10.7554/eLife.85444. 10.7554/eLife.85444 PubMed 37548359