Pb-TRE3G-SpCas9-IRES-blast
(Plasmid
#195506)
-
PurposeInducible Piggybac vector expressing SpCas9 with Blasticidin selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195506 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepiggyBac
- Backbone size w/o insert (bp) 8872
- Total vector size (bp) 12975
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4103
- Promoter TRE
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgaaagccatacgggaagc
- 3′ sequencing primer gagctcgtttagtgaaccgtc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was cloned by Andrew Spencley in laboratory of Joanna Wysocka.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pb-TRE3G-SpCas9-IRES-blast was a gift from Joanna Wysocka (Addgene plasmid # 195506 ; http://n2t.net/addgene:195506 ; RRID:Addgene_195506) -
For your References section:
A genome-wide genetic screen uncovers determinants of human pigmentation. Bajpai VK, Swigut T, Mohammed J, Naqvi S, Arreola M, Tycko J, Kim TC, Pritchard JK, Bassik MC, Wysocka J. Science. 2023 Aug 11;381(6658):eade6289. doi: 10.1126/science.ade6289. Epub 2023 Aug 11. 10.1126/science.ade6289 PubMed 37561850