Halo-TMD
(Plasmid
#195347)
-
PurposeFluorescent labeling for cell membranes
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneTfR-sfGFP-myc tag-SpyCatcher003 Sequences
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 5810
- Total vector size (bp) 6698
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHaloTag
-
SpeciesSynthetic
-
Insert Size (bp)888
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCGGCACGGGCTTTCCGTTTG
- 3′ sequencing primer TTCCAGCCCGGAGATCTCCAGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.04.510821v2 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-TMD was a gift from Allen Liu (Addgene plasmid # 195347 ; http://n2t.net/addgene:195347 ; RRID:Addgene_195347) -
For your References section:
Mechanosensitive Channel-Based Optical Membrane Tension Reporter. Hsu YY, Resto Irizarry AM, Fu J, Liu AP. ACS Sens. 2023 Jan 27;8(1):12-18. doi: 10.1021/acssensors.2c01921. Epub 2023 Jan 6. 10.1021/acssensors.2c01921 PubMed 36608338
Map uploaded by the depositor.
