GFP-itis pBE-nt
(Plasmid #195343)

• Purpose: Base editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNA
• Depositing Lab: Alexis Komor
• Publication: Vasquez et al CRISPR J. 2023 Apr 20. doi: 10.1089/crispr.2023.0002.

Backbone

• Vector backbone: unknown
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: ecTadA(8e)-SpCas9-NG
• Alt name: ABE8e A to G base editor
• Species: Synthetic; E. coli
• Insert Size (bp): 4650
• Mutation: SpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F, A1322R, R1335V, T1337R
• Promoter: ProC

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: cagctaacaccacgtcgt

Gene/Insert 2

• Gene/Insert name: gRNA gtgcacgacgccgtatgcga
• Promoter: Lac

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: gatcgacctgtctcagctgggaggt

Resource Information

• Supplemental Documents:
  • pME176_01.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.02.06.527367v1 for bioRxiv preprint.