1B-GFP1-10
(Plasmid #193867)

• Purpose: E. coli expression vector for Hisx6 tagged GFP1-10.
• Depositing Lab: Markita Landry
• Publication: Wang et al Commun Biol. 2023 Aug 12;6(1):840. doi: 10.1038/s42003-023-05191-5.

Backbone

• Vector backbone: 1B
• Backbone size w/o insert (bp): 5328
• Total vector size (bp): 5997
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: sfGFP1-10
• Species: Synthetic
• Insert Size (bp): 648
• Promoter: T7 Promoter
• Tag / Fusion Protein:
  • 6xHis (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • 1b-gfp1-10.gb
• A portion of this plasmid was derived from a plasmid made by: sfGFP1-10 sequence cloned from PEP101E (Addgene: Plasmid #97387)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry