Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SpyCatcher003-sfGFP
(Plasmid #133449)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 133449 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJ404
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5136
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpyCatcher003-sfGFP
  • Species
    Synthetic
  • Insert Size (bp)
    1149
  • Promoter T5
  • Tags / Fusion Proteins
    • His6 (N terminal on backbone)
    • TEV site (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer lacOT5 (Gcgctcacaattccacaacggtttccc)
  • 3′ sequencing primer Term2 (CGAAAGGCTCAGTCGAAAGAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SpyCatcher003-sfGFP was a gift from Mark Howarth (Addgene plasmid # 133449 ; http://n2t.net/addgene:133449 ; RRID:Addgene_133449)
  • For your References section:

    Approaching infinite affinity through engineering of peptide-protein interaction. Keeble AH, Turkki P, Stokes S, Khairil Anuar INA, Rahikainen R, Hytonen VP, Howarth M. Proc Natl Acad Sci U S A. 2019 Dec 10. pii: 1909653116. doi: 10.1073/pnas.1909653116. 10.1073/pnas.1909653116 PubMed 31822621