pHAGE2-TetOminiCMV-Oct4-p2a-Sox2-17-t2a-Klf4-e2a-cMyc
(Plasmid
#193346)
-
PurposetetO-OS*KM (Dox-inducible reprogramming lentiviral vector expressing mouse Oct4 + super-Sox + Klf4 + cMyc)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE2
- Backbone size w/o insert (bp) 6247
- Total vector size (bp) 11548
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOct4-p2a-Sox2-17-t2a-Klf4-e2a-cMyc
-
Alt namePou5f1
-
Alt namesuperSOX
-
Alt nameMyc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)5301
-
MutationSox2-17 is engineered highly cooperative chimeric transcription factor, where the following elements of Sox2 were swapped with Sox17: 43-47, 61, 65-86 and CTD
-
Entrez GeneKlf4 (a.k.a. EZF, Gklf, Zie)
-
Entrez GenePou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
-
Entrez GeneSox2 (a.k.a. Sox-2, lcc, ysb)
- Promoter TetO mini CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (additional NotI site is present in Sox2-17 sequence) (unknown if destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer gagacgccatccacgctgt
- 3′ sequencing primer AGGAAGGTCCGCTGGATTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.09.23.509242v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE2-TetOminiCMV-Oct4-p2a-Sox2-17-t2a-Klf4-e2a-cMyc was a gift from Hans Schöler (Addgene plasmid # 193346 ; http://n2t.net/addgene:193346 ; RRID:Addgene_193346) -
For your References section:
Highly cooperative chimeric super-SOX induces naive pluripotency across species. MacCarthy CM, Wu G, Malik V, Menuchin-Lasowski Y, Velychko T, Keshet G, Fan R, Bedzhov I, Church GM, Jauch R, Cojocaru V, Scholer HR, Velychko S. Cell Stem Cell. 2024 Jan 4;31(1):127-147.e9. doi: 10.1016/j.stem.2023.11.010. Epub 2023 Dec 22. 10.1016/j.stem.2023.11.010 PubMed 38141611