pX459_gRNA pAS single_hspCas9
(Plasmid
#193311)
-
PurposeCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988)
-
Backbone manufacturerFeng Zhang laboratory
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
-
gRNA/shRNA sequenceGTCACGACGTTGTAAAACGA
-
SpeciesSynthetic
-
Mutationnot applicable
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459_gRNA pAS single_hspCas9 was a gift from Simon Elsaesser (Addgene plasmid # 193311 ; http://n2t.net/addgene:193311 ; RRID:Addgene_193311) -
For your References section:
Generation of Amber Suppression Cell Lines Using CRISPR-Cas9. Meineke B, Elsasser SJ. Methods Mol Biol. 2023;2676:169-180. doi: 10.1007/978-1-0716-3251-2_12. 10.1007/978-1-0716-3251-2_12 PubMed 37277632