pCXLE-mCherry-t2a-SOX2-17-p2a-KLF4
(Plasmid #193294)

• Purpose: episomal mCherry-hS*K (expressing mCherry + human super-SOX + KLF4) for integration-free naïve conversion
• Depositing Lab: Hans Schöler
• Publication: MacCarthy et al Cell Stem Cell. 2024 Jan 4;31(1):127-147.e9. doi: 10.1016/j.stem.2023.11.010. Epub 2023 Dec 22.

Backbone

• Vector backbone: pCXLE
• Backbone size w/o insert (bp): 10180
• Total vector size (bp): 13653
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mCherry-t2a-SOX2-17-p2a-KLF4
• Alt name: superSOX
• Alt name: S*
• Alt name: KLF4
• Species: H. sapiens (human); Discosoma
• Insert Size (bp): 3473
• Mutation: SOX2-17 is engineered highly cooperative chimeric transcription factor, where the following elements of SOX2 were swapped with SOX17: 43-47, 61, 65-86 and CTD
• Entrez Gene: SOX2 (a.k.a. ANOP3, MCOPS3)
• Entrez Gene: KLF4 (a.k.a. EZF, GKLF)
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: tctgctaaccatgttcatgccttc
• 3′ sequencing primer: AGGAAGGTCCGCTGGATTGA

Resource Information

• Supplemental Documents:
  • pCXLE-mCherry-t2a-hSOX2-17-p2a-KLF4.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.09.23.509242v1 for BioRxiv preprint