pLentiCRISPRv2-sgLmnb2-HepmCherry
(Plasmid
#192830)
-
PurposeExpresses sgRNA targeting Lmnb2 and mCherry from hepatocyte-specific promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCRISPRv2-Stuffer-HepmCherry
-
Backbone manufacturerKnouse Lab
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
gRNA/shRNA sequenceAGGTACGGGAGACCCGACGG
-
SpeciesM. musculus (mouse)
- Promoter U6 for sgRNA and hepatocyte-specific promoter (HS-CRM8-TTRmin module from Chuah et al. Molecular Therapy 2014) for mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv2-sgLmnb2-HepmCherry was a gift from Kristin Knouse (Addgene plasmid # 192830 ; http://n2t.net/addgene:192830 ; RRID:Addgene_192830) -
For your References section:
Genome-scale CRISPR screening in a single mouse liver. Keys HR, Knouse KA. Cell Genom. 2022 Dec 14;2(12):100217. doi: 10.1016/j.xgen.2022.100217. Epub 2022 Nov 15. 10.1016/j.xgen.2022.100217 PubMed 36643909