Skip to main content
Addgene

pet21a-aGFPnb-minimizer-cys-linker-YbbR-(PAS)5-H6
(Plasmid #192789)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192789 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pet21a (+)
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5443
  • Total vector size (bp) 5873
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    antiGFP nanobody minimizer
  • Species
    Camelus dromedarius
  • Insert Size (bp)
    528
  • Tags / Fusion Proteins
    • ybbR (C terminal on insert)
    • H6 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TTATGCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Reference to anti-GFP nanobody minimizer:
Kirchhofer A, Helma J, Schmidthals K, Frauer C, Cui S, Karcher A, Pellis M, Muyldermans S, Casas-Delucchi CS, Cardoso MC, Leonhardt H, Hopfner KP, Rothbauer U. Modulation of protein properties in living cells using nanobodies. Nat Struct Mol Biol. 2010 Jan;17(1):133-8. doi: 10.1038/nsmb.1727. Epub 2009 Dec 13. PMID: 20010839.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pet21a-aGFPnb-minimizer-cys-linker-YbbR-(PAS)5-H6 was a gift from Jacob Piehler (Addgene plasmid # 192789 ; http://n2t.net/addgene:192789 ; RRID:Addgene_192789)

  • For your References section:

    Four-color single-molecule imaging with engineered tags resolves the molecular architecture of signaling complexes in the plasma membrane. Sotolongo Bellon J, Birkholz O, Richter CP, Eull F, Kenneweg H, Wilmes S, Rothbauer U, You C, Walter MR, Kurre R, Piehler J. Cell Rep Methods. 2022 Feb 4;2(2):100165. doi: 10.1016/j.crmeth.2022.100165. eCollection 2022 Feb 28. 10.1016/j.crmeth.2022.100165 PubMed 35474965
Related items:
Commonly requested with: