pSems-leader-SNAPf-mXFPe-IFNAR1(28-557)
(Plasmid
#192785)
-
PurposeExpression of SNAPf and mXFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopy
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192785 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSEMS(26m)
-
Backbone manufacturerCovalys, NEB
- Backbone size w/o insert (bp) 5787
- Total vector size (bp) 8186
-
Modifications to backboneoriginal SNAP-tag substituted
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFNAR1
-
Alt nameInterferon alpha/beta receptor subunit 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2988
-
MutationmXFPe: tyrosine 66 to phenylalanine, asparagine 198 to aspartic acid and tyrosine 200 to phenylalanine
-
GenBank IDNM_000629.3
-
Entrez GeneIFNAR1 (a.k.a. AVP, IFN-alpha-REC, IFNAR, IFNBR, IFRC, IMD106)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Ig k-chain leader sequence (N terminal on insert)
- SNAPf-tag (N terminal on insert)
- mXFPe (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAACAGCTGGCCCTCGCAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSems-leader-SNAPf-mXFPe-IFNAR1(28-557) was a gift from Jacob Piehler (Addgene plasmid # 192785 ; http://n2t.net/addgene:192785 ; RRID:Addgene_192785) -
For your References section:
Four-color single-molecule imaging with engineered tags resolves the molecular architecture of signaling complexes in the plasma membrane. Sotolongo Bellon J, Birkholz O, Richter CP, Eull F, Kenneweg H, Wilmes S, Rothbauer U, You C, Walter MR, Kurre R, Piehler J. Cell Rep Methods. 2022 Feb 4;2(2):100165. doi: 10.1016/j.crmeth.2022.100165. eCollection 2022 Feb 28. 10.1016/j.crmeth.2022.100165 PubMed 35474965