Skip to main content
Addgene

pSems-leader-SNAPf-mEGFPm-IFNAR1(28-557)
(Plasmid #192704)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192704 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSEMS(26m)
  • Backbone manufacturer
    Covalys, NEB
  • Backbone size w/o insert (bp) 5787
  • Total vector size (bp) 8186
  • Modifications to backbone
    original SNAP-tag substituted
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFNAR1
  • Alt name
    Interferon alpha/beta receptor subunit 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2988
  • Mutation
    meGFPm: gluatmic acid 142 to asparagine and histidine 164 to asparagine
  • GenBank ID
    NM_000629.3
  • Entrez Gene
    IFNAR1 (a.k.a. AVP, IFN-alpha-REC, IFNAR, IFNBR, IFRC, IMD106)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Ig k-chain leader sequence (N terminal on insert)
    • SNAPf-tag (N terminal on insert)
    • meGFPm (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAACAGCTGGCCCTCGCAGA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSems-leader-SNAPf-mEGFPm-IFNAR1(28-557) was a gift from Jacob Piehler (Addgene plasmid # 192704 ; http://n2t.net/addgene:192704 ; RRID:Addgene_192704)

  • For your References section:

    Four-color single-molecule imaging with engineered tags resolves the molecular architecture of signaling complexes in the plasma membrane. Sotolongo Bellon J, Birkholz O, Richter CP, Eull F, Kenneweg H, Wilmes S, Rothbauer U, You C, Walter MR, Kurre R, Piehler J. Cell Rep Methods. 2022 Feb 4;2(2):100165. doi: 10.1016/j.crmeth.2022.100165. eCollection 2022 Feb 28. 10.1016/j.crmeth.2022.100165 PubMed 35474965
Related items: