-
Purposeintronized ttLbCas12a for in planta expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192453 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAGM3946
-
Backbone manufacturerSylvestre Marillonnet
- Backbone size w/o insert (bp) 2073
-
Vector typeCRISPR, Synthetic Biology ; MoClo compatible Level 0 module
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametemperature-tolerant LbCas12a with introns (BsaI-flanked Golden Gate module, MoClo L0)
-
Alt namettLbCas12a-i
-
SpeciesA. thaliana (mustard weed); Synthetic; Lachnospiraceae bacterium ND2006
-
Insert Size (bp)4988
-
Mutationtemperature-tolerant mutation (D156R)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (AATG) (destroyed during cloning)
- 3′ cloning site BsaI (TTCG) (destroyed during cloning)
- 5′ sequencing primer CCTGTCGGGTTTCGCCACCTC
- 3′ sequencing primer GCCGTTACCACCGCTGCGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAGT8163 (AATG_ttLbCas12a-i_TTCG) was a gift from Tom Schreiber (Addgene plasmid # 192453 ; http://n2t.net/addgene:192453 ; RRID:Addgene_192453) -
For your References section:
Enhancing gene editing and gene targeting efficiencies in Arabidopsis thaliana by using an intron-containing version of ttLbCas12a. Schindele P, Merker L, Schreiber T, Prange A, Tissier A, Puchta H. Plant Biotechnol J. 2023 Mar;21(3):457-459. doi: 10.1111/pbi.13964. Epub 2022 Nov 30. 10.1111/pbi.13964 PubMed 36382936