Skip to main content
Addgene
Open Menu

pAGT8163 (AATG_ttLbCas12a-i_TTCG)
(Plasmid #192453)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192453 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 192453-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 192453-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pAGM3946
  • Backbone manufacturer
    Sylvestre Marillonnet
  • Backbone size w/o insert (bp) 2073
  • Vector type
    CRISPR, Synthetic Biology ; MoClo compatible Level 0 module

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    temperature-tolerant LbCas12a with introns (BsaI-flanked Golden Gate module, MoClo L0)
  • Alt name
    ttLbCas12a-i
  • Species
    A. thaliana (mustard weed); Synthetic; Lachnospiraceae bacterium ND2006
  • Insert Size (bp)
    4988
  • Mutation
    temperature-tolerant mutation (D156R)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (AATG) (destroyed during cloning)
  • 3′ cloning site BsaI (TTCG) (destroyed during cloning)
  • 5′ sequencing primer CCTGTCGGGTTTCGCCACCTC
  • 3′ sequencing primer GCCGTTACCACCGCTGCGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAGT8163 (AATG_ttLbCas12a-i_TTCG) was a gift from Tom Schreiber (Addgene plasmid # 192453 ; http://n2t.net/addgene:192453 ; RRID:Addgene_192453)

  • For your References section:

    Enhancing gene editing and gene targeting efficiencies in Arabidopsis thaliana by using an intron-containing version of ttLbCas12a. Schindele P, Merker L, Schreiber T, Prange A, Tissier A, Puchta H. Plant Biotechnol J. 2023 Mar;21(3):457-459. doi: 10.1111/pbi.13964. Epub 2022 Nov 30. 10.1111/pbi.13964 PubMed 36382936
Related items:
Commonly requested with: