pTarget: Ptaq-RFP_PlacIq-GFP
(Plasmid #192280)

• Purpose: RFP expressed under constitutive promoter Ptaq and GFP expressed under constitutive promoter Placiq
• Depositing Lab: John van der Oost
• Publication: Wu et al Mol Cell. 2022 Dec 1;82(23):4487-4502.e7. doi: 10.1016/j.molcel.2022.11.003. Epub 2022 Nov 24.

Backbone

• Vector backbone: pAU66
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: RFP
• Species: Synthetic
• Promoter: Ptaq

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AatII (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: AGAAAGCCATCCAGTTTACTTTGC

Gene/Insert 2

• Gene/Insert name: GFP
• Species: Synthetic
• Promoter: PlacIq

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GTCGAGTgcaaaacctttcgcggtatggcA

Resource Information

• Supplemental Documents:
  • Copy of pTarget-divergent (seq_rgUkDMph).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry