CCR5_gRNA_pX459
(Plasmid
#192268)
-
PurposegRNA expression for CRISPR Genome Editing of CCR5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192268 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0
-
Backbone manufacturerFeng Zhang
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCCR5 guide RNA
-
gRNA/shRNA sequenceGGAGAGCTTGGCTCTGTTGG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 3′ sequencing primer cgtaagttatgtaacgggtacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CCR5_gRNA_pX459 was a gift from Shantanu Chowdhury (Addgene plasmid # 192268 ; http://n2t.net/addgene:192268 ; RRID:Addgene_192268) -
For your References section:
Human telomerase is directly regulated by non-telomeric TRF2-G-quadruplex interaction. Sharma S, Mukherjee AK, Roy SS, Bagri S, Lier S, Verma M, Sengupta A, Kumar M, Nesse G, Pandey DP, Chowdhury S. Cell Rep. 2021 May 18;35(7):109154. doi: 10.1016/j.celrep.2021.109154. 10.1016/j.celrep.2021.109154 PubMed 34010660