ploxP unc-119
(Plasmid #19185)

• Depositing Lab: Al Fisher
• Publication: Zhang et al BMC Dev Biol. 2008 Dec 30;8(1):119.

Backbone

• Vector backbone: pMOD4
• Backbone manufacturer: Epicentre
• Backbone size w/o insert (bp): 2100
• Vector type: Recombineering

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): EC100pir116
• Growth instructions: EC100pir116 or other pir containing bacteria
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: unc-119
• Species: C. elegans (nematode)
• Insert Size (bp): 5733
• Mutation: contains loxP site just 5' to ApaI site
• Entrez Gene: unc-119 (a.k.a. CELE_M142.1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ApaI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GTCAGTGAGCGAGGAAGCGGAAG
• 3′ sequencing primer: ATTCAGGCTGCGCAACTGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: unc-119 sequence is from pDP#MM016b
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Few mismatches between Addgene and depositor sequence are in the 3' UTR and shouldn't have any impact on plasmid's function