pMOD4 GFP
(Plasmid
#19181)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 19181 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMOD4
-
Backbone manufacturerEpicentre
- Backbone size w/o insert (bp) 2050
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)EC100pir116
-
Growth instructionsEC100pir116 or other pir containing bacteria
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGreen fluorescent protein
-
Alt nameGFP
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)910
-
MutationS65C, contains synthetic introns for C. elegans
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- daf-12 N-term 328 amino acids (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTCAGTGAGCGAGGAAGCGGAAG
- 3′ sequencing primer ATTCAGGCTGCGCAACTGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGFP sequence is from pPD117.01
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMOD4 GFP was a gift from Al Fisher (Addgene plasmid # 19181 ; http://n2t.net/addgene:19181 ; RRID:Addgene_19181) -
For your References section:
A simplified, robust, and streamlined procedure for the production of C. elegans transgenes via recombineering. Zhang Y, Nash L, Fisher AL.. BMC Dev Biol. 2008 Dec 30;8(1):119. 10.1186/1471-213X-8-119 PubMed 19116030