pMOD4 RT-G
(Plasmid
#19184)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 19184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMOD4
-
Backbone manufacturerEpicentre
- Backbone size w/o insert (bp) 2100
-
Vector typeRecombineering
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Tetracycline, 100 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109 lambda pir
-
Growth instructionsJM109 lambda pir or other non-pir116 pir containing bacteria
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namerpsL tetA
-
Alt nameRT cassette
-
SpeciesE.coli
-
Insert Size (bp)2548
-
Tags
/ Fusion Proteins
- 50 nucleotides of FLAG-GFP (N terminal on insert)
- 50 nucleotides of FLAG-GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTCAGTGAGCGAGGAAGCGGAAG
- 3′ sequencing primer ATTCAGGCTGCGCAACTGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRT sequence is from pBAC-RT
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMOD4 RT-G was a gift from Al Fisher (Addgene plasmid # 19184 ; http://n2t.net/addgene:19184 ; RRID:Addgene_19184) -
For your References section:
A simplified, robust, and streamlined procedure for the production of C. elegans transgenes via recombineering. Zhang Y, Nash L, Fisher AL.. BMC Dev Biol. 2008 Dec 30;8(1):119. 10.1186/1471-213X-8-119 PubMed 19116030