pMOD4 galK-GT
(Plasmid #19183)

• Depositing Lab: Al Fisher
• Publication: Zhang et al BMC Dev Biol. 2008 Dec 30;8(1):119.

Backbone

• Vector backbone: pMOD4
• Backbone manufacturer: Epicentre
• Backbone size w/o insert (bp): 2100
• Vector type: Recombineering

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): EC100pir116
• Growth instructions: EC100pir116 or other pir containing bacteria
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: galK
• Species: E.coli
• Insert Size (bp): 1612
• Entrez Gene: galK (a.k.a. b0757, ECK0746, galA)
• Tags / Fusion Proteins:
  • 50 nucleotides from N-term TAP, C-term TAP, and FLAG-GFP (N terminal on insert)
  • 50 nucleotides from N-term TAP, C-term TAP, and FLAG-GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SphI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: GTCAGTGAGCGAGGAAGCGGAAG
• 3′ sequencing primer: ATTCAGGCTGCGCAACTGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: galK sequence is from pGalK (Warming and Copeland)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry