pMOD4 GFP
(Plasmid #19181)

• Depositing Lab: Al Fisher
• Publication: Zhang et al BMC Dev Biol. 2008 Dec 30;8(1):119.

Backbone

• Vector backbone: pMOD4
• Backbone manufacturer: Epicentre
• Backbone size w/o insert (bp): 2050
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): EC100pir116
• Growth instructions: EC100pir116 or other pir containing bacteria
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Green fluorescent protein
• Alt name: GFP
• Species: C. elegans (nematode)
• Insert Size (bp): 910
• Mutation: S65C, contains synthetic introns for C. elegans
• Tags / Fusion Proteins:
  • FLAG (N terminal on insert)
  • daf-12 N-term 328 amino acids (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GTCAGTGAGCGAGGAAGCGGAAG
• 3′ sequencing primer: ATTCAGGCTGCGCAACTGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GFP sequence is from pPD117.01

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry