Skip to main content
Addgene

pATmin-GG
(Plasmid #191352)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191352 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pQexp
  • Backbone manufacturer
    PMID 19775243
  • Backbone size w/o insert (bp) 6972
  • Total vector size (bp) 6299
  • Modifications to backbone
    Drop-out Plac-RFP cassette flanked with BsaI sites
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Plac-RFP (IPTG-inducible red fluorescent protein)
  • Insert Size (bp)
    1103
  • Promoter Plac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBi (destroyed during cloning)
  • 5′ sequencing primer CGAGTCAGTGAGCGAGGAA
  • 3′ sequencing primer TTGCTTCTAAGGTCGACGGA
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pATmin-GG was a gift from Andrew Tolonen (Addgene plasmid # 191352 ; http://n2t.net/addgene:191352 ; RRID:Addgene_191352)

  • For your References section:

    Tuning of Gene Expression in Clostridium phytofermentans Using Synthetic Promoters and CRISPRi. Rostain W, Zaplana T, Boutard M, Baum C, Tabuteau S, Sanitha M, Ramya M, Guss A, Ettwiller L, Tolonen AC. ACS Synth Biol. 2022 Dec 16;11(12):4077-4088. doi: 10.1021/acssynbio.2c00385. Epub 2022 Nov 25. 10.1021/acssynbio.2c00385 PubMed 36427328
Related items:
Commonly requested with: