Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJB07
(Plasmid #190481)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190481 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJB11
  • Total vector size (bp) 8357
  • Modifications to backbone
    Addition of region of homology for pyrE deletion, gRNA, xylR-driven promotion region
  • Vector type
    E. coli / B. subtilis - C. difficile shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Upstream & Downstream pyrE deletion region
  • Species
    C. difficile
  • Insert Size (bp)
    2000

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ttatcaggaaacagctatgaccgcggccgc
  • 3′ sequencing primer agugccaaguugcaugucugcaggcucgag
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    gRNA
  • Insert Size (bp)
    140

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer TTATGAAGTGGCATTCAAGGAGGGggtacc
  • 3′ sequencing primer caggcuucuuauuuuuaugcuagcACGCGU
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJB07 was a gift from Joseph Sorg (Addgene plasmid # 190481 ; http://n2t.net/addgene:190481 ; RRID:Addgene_190481)
  • For your References section:

    Plasmid Sequence and Availability for an Improved Clostridioides difficile CRISPR-Cas9 Mutagenesis System. Brehm JN, Sorg JA. Microbiol Resour Announc. 2022 Dec 15;11(12):e0083322. doi: 10.1128/mra.00833-22. Epub 2022 Nov 7. 10.1128/mra.00833-22 PubMed 36342279