Halo-Rab6A
(Plasmid
#190171)
-
PurposeExpresses HaloTag-Rab6A in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGFP-N1
- Backbone size w/o insert (bp) 3941
- Total vector size (bp) 5516
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag-Rab6A
-
Alt nameHalo-Rab6A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1575
-
GenBank IDNM_198896.2
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGATTTCCAAGTCTCCACCCC
- 3′ sequencing primer GGGAGGTGTGGGAGGTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-Rab6A was a gift from Anna Akhmanova (Addgene plasmid # 190171 ; http://n2t.net/addgene:190171 ; RRID:Addgene_190171) -
For your References section:
Opto-katanin, an optogenetic tool for localized, microtubule disassembly. Meiring JCM, Grigoriev I, Nijenhuis W, Kapitein LC, Akhmanova A. Curr Biol. 2022 Nov 7;32(21):4660-4674.e6. doi: 10.1016/j.cub.2022.09.010. Epub 2022 Sep 28. 10.1016/j.cub.2022.09.010 PubMed 36174574